Reach Us +32 28087017

Sweet Regulation of Human Glucocorticoid Receptor Transcriptional Activity

Xin WEN1,2*,Wen Wei ZENG3

1(V) Developmental Neurobiology Section, NHLBI, NIH, Bethesda, MD 20892, USA

2(C ) UGO, Eunice Kennedy Shriver, NICHD, NIH, Bethesda, MD 20892, USA

3University of Maryland, College Park, MD 20742, USA

*Corresponding Author:
Xin WEN
Developmental Neurobiology Section, NHLBI, NIH, Bethesda, MD 20892, USA
Tel: +12405063095
E-mail: [email protected]

Received date: August 19, 2015; Accepted date: September 15, 2015; Published date: September 22, 2015

Citation: WEN X (2015) Sweet Regulation of Human Glucocorticoid Receptor Transcriptional Activity. J Obes Eat Disord 1:9. doi: 10.4172/2471-8203.100004

Copyright: © 2016, Xin WEN. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

 
Visit for more related articles at Journal of Obesity & Eating Disorders

Abstract

This study is to understanding the transcription profile of human Glucocorticoid Receptor GR, gene of a neuroendocrine, stress response and obesity related receptor. For GR, relative luciferase activity RLA and the distribution of phosphorylation [P], glycosylation sites [G] on transcription factor for promoter model were plotted on the same chart. Within the 3.2 kb upstream of the methionine ATG, for GR, trend lines of RLA with that of [G] or ([P]-[G]), both tend to have negative reciprocal relationship. It brings up the question: for the neuendocrine glucocorticoid receptor, does the nutrition and obesity related glycosylation regulated the transcriptional activity in a negative reciprocal way? In conclusion, for GR, the reciprocal relation between trend line of [G], ([P] ± [G]) or [P] and that of RLA, give a specific digit evidence for the first time to the theory, which the structure related glycosylation and the signal sensing phosphorylation, exhibit either independently or Interactively on regulation of transcription activity. Abbreviations: RLA: Relative Luciferase Activity; Luciferase/β-Galactosidase Activity; DLA: Dual Luciferase Assay; GR: Human Glucocorticoid Receptor; TF: Transcription Factor; P1: Construct Plasmid 1; P7: Construct Plasmid 7. GR-P1: Construct Plasmid 1 for Human Glucocorticoid Receptor; GR-P7: Constructs Plasmid 7 for Human Glucocorticoid Receptor; [P]: Number of Phosphorylation Sites on TF for Promoter Models; [G]: Number of Glycosylation Sites on TF for Promoter Models; [P]-[G]: Number of Difference between Phosphorylation and Glycosylation Sites on TF for Promoter Models; [P]+[G]: Number for Sum of Phosphoylation and Glycosylation Sites on TF for Promoter Models

Introduction

Glucocorticoid receptor signaling is in physiological and pathophysiological conditions in the major organ systems in the human body. Among the non-genomic signaling of GRs [1], the rapid actions of GRs, occur as a result of physiochemical interactions of glucocorticoids with the cell membrane; have been reported in various systems, including the cardiovascular, immune and neuroendocrine

In the embryonic development, the present of functional GR during gestation is essential for postnatal survival as well as during development. In the nervous system, GR functions in the brain correlate positively with anxiety behavior. The GR in the forebrain has been shown to regulate the HPA axis and behavior under stressed conditions. In the cardiovascular system, glucocorticoid regulation of cell size, apoptosis, inflammatory state, and vascular tone appears to be vital for proper cardiac function. GR signal is associated with immune system, respiratory system as well as reproductive system. Considerable evidence implicating GR signaling is in maintaining glucose homeostasis, regulating metabolic homeostasis e.g. Cushing’s disease or Addison’s disease. In musculoskeletal system, the activity of GR in skeletal muscle has been shown to correlate positively with metabolic syndrome. And in Integumentary system, the antiproliferative effects of the GR in keratinocytes were shown to be regulated by transrepression, and GR in the skin physiologically regulate epithelial integrity and immune function. And the glucocorticoid receptor plays the dominant role in adipogenesis and adipokine production in human adipocytes [2], On the other hand, primary gene induction or repression in eukaryotes does not require protein synthesis [3], suggesting the involvement of posttranslational modifications [4,5]. Since many different types of stimuli that affect gene expression also lead to the activation of protein kinases, analysis of transcription factor phosphorylation is essential for complete understanding of the signal pathways. The activity of transcription factors may be modulated by their signal-sensing domain including phosphorylation [6]. In addition, as nutrient sensitive sugar modification, glycosylation, interfere with the epigenetic control of gene expression.

GR receptors are involved in anxiety, cardiovascular, apoptosis, inflammatory, immune system, respiratory, reproductive system, musculoskeletal and integumentary system diseases, as well as obesity and neuroendocrine disease. Moreover, phosphorylation or glycosylation are perhaps required for the activation of transcription factors. Thus, the regulatory mechanism and post translation modification in the epigenetic transcription regulation of glucocorticoid receptor would be beneficial.

Methods

For GR, relative luciferase activity (in HeLa (human cervical carcinoma cells) is from Figure 7 in Vedeckis’s paper [7], and the sequence information for the corresponding constructs is from Figure 4 in the same paper. Afterwards, promoter model [8] [A promoter model represents a framework of two or more conserved elements (e.g., transcription factor binding sites) with a defined distance (and strand orientation). Usually, promoter models are much more specific than single elements like transcription factor binding sites. Therefore, a promoter model can give higher evidence that the matching sites are functional was inspected by Genomatix (https://www.genomatix.com/). The glycosylation (Table 1) and phosphorylation sites (Table 2) on the promoter model were searched by Protein Knowledge bases of Uniprot (https://www.uniprot.org/).

Promoter Model Sequence bp G1 TF
EGRF_SP1F_01 GTTGGGGGCGGGGGGCG -3096 G V$SP1F
SP1F_SP1F_01 GTTGGGGGCGGGGGGCG -3096 G V$SP1F
SP1F_SP1F_06 GTTGGGGGCGGGGGGCG -3096 G V$SP1F
SP1F_ETSF_04 GTTGGGGGCGGGGGGCG -3096 G V$SP1F
SP1F_KLFS_01 GTTGGGGGCGGGGGGCG -3096 G V$SP1F
SP1F_SP1F_06 GCGGGGGGCGAAGCGCG -3089 G V$SP1F
SP1F_SP1F_01 GCGGGGGGCGAAGCGCG -3089 G V$SP1F
SP1F_SP1F_05 GCGGGGGGCGAAGCGCG -3089 G V$SP1F
SP1F_SP1F_01 GCACCGGGCGGGGCGGC -3070 G V$SP1F
KLFS_SP1F_01 GCACCGGGCGGGGCGGC -3070 G V$SP1F
SP1F_SP1F_06 GCACCGGGCGGGGCGGC -3070 G V$SP1F
SP1F_KLFS_01 GCACCGGGCGGGGCGGC -3070 G V$SP1F
SP1F_SP1F_05 GCACCGGGCGGGGCGGC -3070 G V$SP1F
SP1F_SP1F_01 GGGCGGGGCGGCCACGC -3065 G V$SP1F
SP1F_SP1F_06 GGGCGGGGCGGCCACGC -3065 G V$SP1F
SP1F_SP1F_01 CGGGGTGGCGGGGCCCG -3015 G V$SP1F
E2FF_SP1F_01 GCGGAGGGCGTGGGGGC -2997 G V$SP1F
SP1F_NF1F_01 GCGGAGGGCGTGGGGGC -2997 G V$SP1F
SP1F_SP1F_01 CGTGGGGGCAGGGACCG -2989 G V$SP1F
SP1F_E2FF_01 CCCTCGGGCGGGGAGCG -2906 G V$SP1F
SP1F_EBOX_SP1F_01 CCCTCGGGCGGGGAGCG -2906 G V$SP1F
SP1F_EBOX_SP1F_01 CCCTCGGGCGGGGAGCG -2906 G V$SP1F
E2FF_SP1F_01 GCCGGGGGTGGAGTGGG -2889 G V$SP1F
EBOX_EBOX_02 GGAGCGCGTGTGT -2876 G V$EBOX
EBOX_EBOX_02 GCGCCACGGCGCG -2852 G V$EBOX
SP1F_EBOX_SP1F_01 GCGCCACGGCGCG -2852 G V$EBOX
SP1F_EBOX_SP1F_01 GCGCCACGGCGCG -2852 G V$EBOX
SP1F_EBOX_SP1F_01 CGAGCGAGCGGGACCGA -2817 G V$SP1F
SP1F_EBOX_SP1F_01 GGCCTGGGCGAGCGAGC -2809 G V$SP1F
P12   -2738    
SP1F_ETSF_02 GCGCGGGGCGGAGGGCT -2584 G V$SP1F
SP1F_ETSF_03 GCGCGGGGCGGAGGGCT -2584 G V$SP1F
SP1F_ETSF_03 TCCATGGGTGGGGGGAG -2524 G V$SP1F
EBOX_E2FF_01 CCGCCACCGTCCG -2400 G V$EBOX
ETSF_SP1F_01 TCCGCAGGCGTCCCCTG -2164 G V$SP1F
ETSF_SP1F_05 TGGCCGGGCCGAGGGGG -2149 G V$SP1F
P2   -1824    
SP1F_SP1F_01 GGCCGGGGCCGGCGTTA -1810 G V$SP1F
SP1F_SP1F_01 GAAGTGGGCGTGTCGGA -1786 G V$SP1F
SP1F_KLFS_01 TTGCGGGGCGGGGGTGG -1710 G V$SP1F
EGRF_SP1F_01 TTGCGGGGCGGGGGTGG -1710 G V$SP1F
P3   -1630    
P4   -1525    
NKXH_CEBP_01 TCCCTCAAGCGACATTATC -1457 G V$NKXH
NFAT_SORY_01 CCAAAACAATATTTCCTAAAACGAA -1430 G V$SORY
SORY_SORY_01 CCAAAACAATATTTCCTAAAACGAA -1430 G V$SORY
CREB_IRFF_01 CTTTTTTGACAGCTGCCTTCA -1398 G V$CREB
SORY_SORY_01 CCAATGAATTTCCATGCCGCTTTTT -1381 G V$SORY
P5   -1322    
SP1F_KLFS_01 GAGAGGGGTGTGGACTT -1260 G V$SP1F
CREB_NFKB_05 ATGCGATGACGTTAGGCAGCA -1198 G V$CREB
P6   -1149    
P7   -1115    
NEUR_SORY_01 AATGAATTATAATGTCTGTGATTAA -324 G V$SORY

Table 1: Glycosylation site on promoter model of GR.

Promoter Model Sequence bp P1 TF
SP1F_ETSF_04 ACTCCCCAGGAAAAAGGGTGG -3113 P V$ETSF
EGRF_SP1F_01 GGAGTTGGGGGCGGGGG -3099 P V$EGRF
SP1F_KLFS_01 AGTTGGGGGCGGGGGGC -3097 P V$KLFS
EGRF_SP1F_01 GTTGGGGGCGGGGGGCG -3096 P V$SP1F
SP1F_SP1F_01 GTTGGGGGCGGGGGGCG -3096 P V$SP1F
SP1F_SP1F_06 GTTGGGGGCGGGGGGCG -3096 P V$SP1F
SP1F_ETSF_04 GTTGGGGGCGGGGGGCG -3096 P V$SP1F
SP1F_KLFS_01 GTTGGGGGCGGGGGGCG -3096 P V$SP1F
KLFS_SP1F_01 GGCGGGGGGCGAAGCGC -3090 P V$KLFS
SP1F_SP1F_06 GCGGGGGGCGAAGCGCG -3089 P V$SP1F
SP1F_SP1F_01 GCGGGGGGCGAAGCGCG -3089 P V$SP1F
SP1F_SP1F_05 GCGGGGGGCGAAGCGCG -3089 P V$SP1F
SP1F_KLFS_01 CGCACCGGGCGGGGCGG -3071 P V$KLFS
SP1F_SP1F_01 GCACCGGGCGGGGCGGC -3070 P V$SP1F
KLFS_SP1F_01 GCACCGGGCGGGGCGGC -3070 P V$SP1F
SP1F_SP1F_06 GCACCGGGCGGGGCGGC -3070 P V$SP1F
SP1F_KLFS_01 GCACCGGGCGGGGCGGC -3070 P V$SP1F
SP1F_SP1F_05 GCACCGGGCGGGGCGGC -3070 P V$SP1F
SP1F_SP1F_01 GGGCGGGGCGGCCACGC -3065 P V$SP1F
SP1F_SP1F_06 GGGCGGGGCGGCCACGC -3065 P V$SP1F
SP1F_SP1F_01 CGGGGTGGCGGGGCCCG -3015 P V$SP1F
E2FF_SP1F_01 GGGTGGCGGGGCCCGCG -3013 P V$E2FF
EBOX_E2FF_01 TCCGCGCGGGCCCCGCC -3009 P V$E2FF
SP1F_NF1F_01 GCGGAGGGCGTGGGGGC -2997 P V$SP1F
SP1F_SP1F_01 CGTGGGGGCAGGGACCG -2989 P V$SP1F
SP1F_NF1F_01 CGCCCCTGCAGTTGCCAAGCG -2966 P V$NF1F
IKRS_AP2F_01 CGCGGGGAACGAT -2934 P V$IKRS
SP1F_E2FF_01 GCGCGGCGGCCGCGGGG -2926 P V$E2FF
IKRS_AP2F_01 CCCGCCCGAGGGGCC -2910 P V$AP2F
SP1F_E2FF_01 CCCTCGGGCGGGGAGCG -2906 P V$SP1F
SP1F_EBOX_SP1F_01 CCCTCGGGCGGGGAGCG -2906 P V$SP1F
SP1F_EBOX_SP1F_01 CCCTCGGGCGGGGAGCG -2906 P V$SP1F
E2FF_SP1F_01 CTCGGGCGGGGAGCGGC -2904 P V$E2FF
E2FF_SP1F_01 GCCGGGGGTGGAGTGGG -2889 P V$SP1F
EBOX_EBOX_02 GGAGCGCGTGTGT -2876 P V$EBOX
EBOX_EBOX_02 GCGCCACGGCGCG -2852 P V$EBOX
SP1F_EBOX_SP1F_01 GCGCCACGGCGCG -2852 P V$EBOX
SP1F_EBOX_SP1F_01 GCGCCACGGCGCG -2852 P V$EBOX
SP1F_EBOX_SP1F_01 CGAGCGAGCGGGACCGA -2817 P V$SP1F
SP1F_EBOX_SP1F_01 GGCCTGGGCGAGCGAGC -2809 P V$SP1F
P12        
AP1R_ETSF_EGRF_01 GATTCTGTGGGTGGAAG -2682 P V$EGRF
AP1R_ETSF_EGRF_01 CTGTGGGTGGAAGGAGACGCC -2676 P V$ETSF
AP1R_ETSF_EGRF_01 AGCTGCTTCGGCCGCTCCGGC -2652 P V$AP1r
SP1F_ETSF_03 GCGCGCCCGGAACCTCGACCC -2613 P V$ETSF
SP1F_ETSF_02 GCGCGGGGCGGAGGGCT -2584 P V$SP1F
SP1F_ETSF_03 GCGCGGGGCGGAGGGCT -2584 P V$SP1F
STAT_NFKB_06 GGGGGAGAGCCCCTA -2533 P V$NFKB
1F_ETSF_03 TCCATGGGTGGGGGGAG -2524 P V$SP1F
SP1F_ETSF_03 TAAAAAAAGGAAGTAAACAGC -2495 P V$ETSF
STAT_NFKB_06 TTTTTTCTAAAAAAAGGAA -2487 P V$STAT
IRFF_NFAT_01 TTTAGAAAAAAAAAATATATT -2478 P V$IRFF
IRFF_NFAT_01 AGGAGGGAAATATATTTTT -2469 P V$NFAT
SMAD_E2FF_01 CTCGGCTGCGG -2421 P V$SMAD
SMAD_E2FF_01 CTGCGGCGGGAACTGCG -2413 P V$E2FF
SP1F_ETSF_02 CTGCGGCGGGAACTGCGGACG -2411 P V$ETSF
EBOX_E2FF_01 CCGCCACCGTCCG -2400 P V$EBOX
AP2F_KLFS_01 ACTCCCCGAGGCTAA -2261 P V$AP2F
AP2F_KLFS_01 GCCTCGGGGAGTGGGGG -2257 P V$KLFS
ETSF_SP1F_01 GAGGGAGAGGAAGAGGCCAGC -2181 P V$ETSF
Promoter Model Sequence bp P TF
ETSF_SP1F_01 TCCGCAGGCGTCCCCTG -2164 P V$SP1F
ETSF_SP1F_05 TGGCCGGGCCGAGGGGG -2149 P V$SP1F
ETSF_SP1F_05 GAGGGGGAGGAACCTGACCTC -2137 P V$ETSF
P2   -1824    
SP1F_SP1F_01 GGCCGGGGCCGGCGTTA -1810 P V$SP1F
SP1F_SP1F_01 GAAGTGGGCGTGTCGGA -1786 P V$SP1F
SP1F_KLFS_01 TTGCGGGGCGGGGGTGG -1710 P V$SP1F
EGRF_SP1F_01 TTGCGGGGCGGGGGTGG -1710 P V$SP1F
SP1F_KLFS_01 CTTGCGGGGCGGGGGTG -1709 P V$KLFS
EGRF_SP1F_01 CCCTTGCGGGGCGGGGG -1707 P V$EGRF
P3   -1630    
BRNF_RXRF_01 GTGGTATTACAAGGTTGCA -1545 P V$BRNF
P4   -1525    
BRNF_RXRF_01 TGGCATGGTTCATTAGGGCCAATTA -1512 P V$RXRF
NKXH_CEBP_01 TCCCTCAAGCGACATTATC -1457 P V$NKXH
NKXH_CEBP_01 CGTTTTAGGAAATAT -1433 P V$CEBP
NFAT_SORY_01 CCAAAACAATATTTCCTAAAACGAA -1430 P V$SORY
SORY_SORY_01 CCAAAACAATATTTCCTAAAACGAA -1430 P V$SORY
NFAT_SORY_01 TTTTAGGAAATATTGTTTT -1429 P V$NFAT
IRFF_NFAT_01 TTTTAGGAAATATTGTTTT -1429 P V$NFAT
IRFF_NFAT_01 ACCCGAAACCAAAACAATATT -1420 P V$IRFF
CREB_IRFF_01 CTTCAAACCCGAAACCAAAAC -1414 P V$IRFF
PBXC_MYOD_01 TTTTGACAGCTGCCTTC -1399 P V$MYOD
CREB_IRFF_01 CTTTTTTGACAGCTGCCTTCA -1398 P V$CREB
PBXC_MYOD_01 CGCTTTTTTGACAGCTG -1394 P V$PBXC
TEAF_TEAF_01 TTCCATGCCGCTT -1384 P V$TEAF
SORY_SORY_01 CCAATGAATTTCCATGCCGCTTTTT -1381 P V$SORY
NFAT_GATA_01 CATGGAAATTCATTGGGCT -1375 P V$NFAT
TEAF_TEAF_01 CTCCATTCGATAC -1361 P V$TEAF
NFAT_GATA_01 AGGCGATAACGAT -1335 P V$GATA
PAX6_CDXF_01 TGCCCCGTTTATCTGAGGC -1323 P V$CDXF
P5   -1322    
CREB_NFKB_05 TGTGGACTTGCCACT -1267 P V$NFKB
SP1F_KLFS_01 GAGAGGGGTGTGGACTT -1260 P V$SP1F
SP1F_KLFS_01 AGAGAGGGGTGTGGACT -1259 P V$KLFS
CREB_NFKB_05 ATGCGATGACGTTAGGCAGCA -1198 P V$CREB
P6   -1149    
P7   -1115    
FKHD_CEBP_01 CCTTTCCAAACAAATAT -913 P V$FKHD
FKHD_CEBP_01 TTTGTTTGGAAAGGA -911 P V$CEBP
NFKB_CEBP_01 TTTGTTTGGAAAGGA -911 P V$CEBP
NFKB_CEBP_01 TAAGTTCTTTCCTTT -902 P V$NFKB
STAT_BRAC_01 TTGGTTCTCAGAAAAGCAA -448 P V$STAT
PBXC_PDX1_01 GCCGTGATTGAAAAGAG -427 P V$PBXC
PBXC_PDX1_01 TAGGAATTTTAATGATCAC -408 P V$PDX1
STAT_BRAC_01 AAAAAAAGGAAGTGTGATCAT -396 P V$BRAC
BRNF_RXRF_01 TGAAGGTTCAAGTTGATGTCAAAGT -363 P V$RXRF
NEUR_SORY_01 ATTACATCTGATT -340 P V$NEUR
BRNF_RXRF_01 ATGTAATGAATTATAATGT -331 P V$BRNF
NEUR_SORY_01 AATGAATTATAATGTCTGTGATTAA -324 P V$SORY
SMAD_FKHD_01 AATGTCTGTGA -321 P $SMAD
SMAD_FKHD_01 CTGTGATTAACAAAGCT -313 P V$FKHD
HNF1_CEBP_01 TTTATTCTGGAAGAT -170 P V$CEBP
HNF1_FKHD_01 GATTCGGAGTTAACTAA -124 P V$HNF1
HNF1_CEBP_01 GATTCGGAGTTAACTAA -124 P V$HNF1
HNF1_FKHD_01 GTTCATTTAACAAGCTG -104 P V$FKHD
GATA_HNF1_01 GGCAGCTTGTTAAATGA -102 P V$HNF1
GATA_HNF1_01 ATCCGATTAGTAA -85 P V$GATA
ETSF_MYBL_01 TCGGATCAGGAAGATAATGTG -74 P V$ETSF
ETSF_MYBL_01 CAAAAACGGGGGGAA -36 P V$MYBL

Table 2 Phosphorylation site on promoter model of GR.

Results

Human Glucocorticoid Receptor

As shown in Figure 1, GR-P1 has RLA of 100, with length of 1692bp, ranging from -2738bp to -1046bp, there are 41 phosphorylation sites and 4 glycosylaton sites on modules between GR-P1 and GR-P2. GR-P2 has RLA of 70.3, with length of 778bp, ranging from -1824bp to -1046bp, there are 22 phosphorylation sites and 6 glycosylaton sites on modules between GR-P2 and GR-P3. GR-P3 has RLA of 80.8, with length of 584bp, ranging from -1630bp to -1046bp, there are 6 phosphorylation sites and 4glycosylaton sites on modules between GR-P3 and GRP4. GR-P4 has RLA of 77.8, with length of 479bp, ranging from -1525bp to -1046bp, there are 1 phosphorylation sites and 0 glycosylaton sites onmodules between GR-P4 and GR-P5. GR-P5 has RLA of 55.9, with length of 276bp, ranging from -1322bp to -1046bp, there are 18 phosphorylation sites and 5 glycosylaton sites on modules between GR-P5 and GR-P6. GR-P6 has RLA of 1.8, with length of 103 bp, ranging from -1149 bp to -1046bp, there are 4 phosphorylation sites and 2 glycosylaton sites on modules between GR-P6 and GR-P7. GR-P7 has RLA of 2.5, with length of 69bp, ranging from -1115bp to -1046bp, there are 22 phosphorylation sites and 1 glycosylaton sites on modules on GR-P7.

obesity-cafeteria-diet-glycosylation

Figure 1: RLA of corresponding plasmids for GR and distribution of phosphorylation site and glycosylation site on TF for promoter model. The RLA of the corresponding plasmids is plotted on upper Y axis (Y>0) with the corresponding sequence of sense primer and that of antisense primer, concurrently, a horizontal line is drawn to link the starting point and ending point of each constructed plasmid respectively. On the other hand, within the 3200 base pair (bp) upstream the methionineATG (0 bp), on the lower Y axis area (Y<0), the phosphorylation (P) sites and glycosylation (G) sites is also pinned on the corresponding sequence (bp) for transcription factors promoter models. It shows the distribution of P and G. GR, plasmids (P1, P2, P3, 21, P4, P5, P6, P7).

If plot according to the RLA data and {the glycosylation site [G], phosphorylation site [P], sum of [P]+[G], difference of [P]-[G] site} of TF for promoter model on the same chart, get Figure 2, the polynomial behavior (Table 3) of GR is: trend line of RLA is (y=3E-10x4+2E-06x3+0.0029x2+1.4998x-58.137); trend line of [G] is (y=2E-10x4-1E-06x3-0.0033x2-3.3676x-1247.4); trend line of [P]- [G] is (y=-2E-10x4-2E-06x3-0.0032x2-2.9062x-920.59); trend line of [P] is (y=-5E-10x4-3E-06x3-0.0066x2-6.2738x-2168); trend line of [P]+[G] is (y=-7E-10x4-4E-06x3-0.0099x2-9.6414x-3415.4). Trend line RLA and trend line of ([G], [P], [P] ± [G]) give an inverted image to each other. In detail, the sign of leading coefficient is opposite to each other, and sign of coefficient of corresponding degree are also opposite to each other. Furthermore, trend line of RLA (y=-2E- 10x4-1E-06x3-0.002x2-2.313x-546.1) and trend line of [G] (y=-2E- 10x4-1E-06x3-0.0033x2-3.3676x-1247.4) tend to have a relation of negative reciprocal (Figure 2b). At the same time, trend line of RLA (y=-2E-10x4-1E-06x3-0.002x2-122.313x-546.1) and trend line of [P]- [G] (y=-2E-10x4-2E-06x3-0.0032x2-2.9062x-920.59) tend to have a relation of negative reciprocal as well (Figure 2a).

Y axis polynomial scheme
RLA   y=3E-10x4+2E-06x3+0.0029x2+1.4998x-58.137
[G]   y=-2E-10x4-1E-06x3-0.0033x2-3.3676x-1247.4
[P]-[G]   y=-2E-10x4-2E-06x3-0.0032x2-2.9062x-920.59
[P]+[G]   y=-7E-10x4-4E-06x3-0.0099x2-9.6414x-3415.4

Table 3: polynomial scheme of GR.

obesity-cafeteria-diet-polynomial

Figure 2: RLA data of GR and {the glycosylation site [G], phosphorylation site [P], sum of [P]+[G], difference of [P]- [G] site} of TF for promoter model. For GR, plot the RLA data and {the glycosylation site [G], phosphorylation site [P], sum of [P]+[G], difference of [P]-[G] site} of TF for promoter model on the same chart, the polynomial behavior of is: trend line of RLA is (y=3E-10x4 +2E-06x3 +0.0029x2 +1.4998x-58.137); trend line of [G] is (y=-2E-10x4 +1E-06x3 -0.0033x2 -3.3676x-1247.4); trend line of [P]-[G] is (y=-2E-10x4 -2E-06x3 -0.0032x2 -2.9062x-920.59); trend line of [P] is (y=-5E-10x4 -3E-06x3 -0.0066x2 - 6.2738x-2168); trend line of [P]+[G] is (y=-7E-10x4 -4E-06x3 -0.0099x2 -9.6414x-3415.4). Trend line RLA and trend line of ([G], [P], [P] ± [G]) give an inverted image to each other. In detail, the sign of leading coefficient is opposite to each other, and sign of coefficient of corresponding degree are also opposite to each other. Furthermore, trend line of RLA (y=3E-10x4 +2E- 06x3 +0.0029x2 +1.4998x-58.137) and trend line of [P]-[G] (y=-2E-10x4 -2E-06x3 -0.0032x2 -2.9062x-920.59) tend to have a relation of negative reciprocal (a). Concurrently, trend line of RLA (y=3E-10x4 +2E-06x3 +0.0029x2 +1.4998x-58.137) and trend line of [G] (y=-2E-10x4 -1E-06x3 -0.0033x2 -3.3676x-1247.4) tend to have a relation of negative reciprocal as well (b).

EDI PREmean (SD) POSTmean (SD) Diference(CI 95%) p
Drive for thinness 9.60 (5.21) 6.88 (4.33) -2.72 (-4.68; -0.76) 0.008
Bulimia 3.04 (4.59) 1.00 (2.66) -2.04 (-3.94;-0.14) 0.16
Body Dissatisfaction 19.20 (4.88) 11.36 (7.11) -7.84 (-11.24; -0.14) 0.65
Ineffectiveness 4.88 (5.47) 4.00 (6.00) -0.88 (-2.70;0.94) <0.001
Perfectionism 4.12 (2.99) 3.36 (2.97) -0.76 (-2.65; 1.13) 0.38
Interpersonal Distrust 3.32 (3.98) 2.88 (3.94) -0.44 (-2.01; 1.13) 0.006
Interoceptive Awareness 6.48 (4.98) 5.28 (4.90) -1.20 (-3.44; 1.04) 0.05
Maturity Fears 4.92 (4.13) 4.16 (3.36) -0.76 (-2.83; 1.31) 0.59
BITE        
Symptoms 12.04 (7.00) 6.32 (4.25) -5.72 (-8.13; -3.31) 0.004
Severity 4.80 (4.94) 2.16 (3.06) -2.64 (-4.48; -0.80) 0.021
ROSEMBERG 29.20 (7.10) 32.64 (4.94) 3.44 (0.21; 6.66) 0.34
BDI 16.35 (10.36) 11.69 (10.09) -4.65 (-8.18; -1.12) <0.001
HDRS 13.21 (6.88) 5.58 (7.00) -7.63 (-11.77;-3.50) 0.33
BSQ 114.68 (38.62) 92.40 (39.29) -22.28 (-35.71;-8.85) <0.001

Table 4 Differences in clinical variables before and after 1 year postsurgery in 22 females patients with morbid obesity.

Discussion

As a result, trend line of RLA (y=-2E-10x4-1E-06x3-0.002x2-2.313x-546.1) and trend line of [G] (y=-2E-10x4-1E-06x3-0.0033x2- 3.3676x-1247.4) tend to have a relation of negative reciprocal (Figure 2b). At the same time, trend line of RLA (y = -2E-10x4 - 1E-06x3 - 0.002x2 - 2.313x - 546.1) and trend line of [P]-[G] (y=-2E- 10x4-2E-06x3-0.0032x2-2.9062x-920.59) tend to have a relation of negative reciprocal as well (Figure 2a). Further investigations are being made to verify the reciprocal relationship.

From the fact shown by the figure that trend line of RLA of GR tends to have a relation of negative reciprocal to that the trend line of the corresponding ([P]-[G]) (Figure 2a), and trend line of ([P]- [G]) is the closest one (among the negative reciprocal relations) which approaching to its corresponding negative reciprocal RLA (Table 3). If it is true, the structure and nutritional element [G] will reduce the regulation of signal sensing phosphorylation [P] to the transcription activity; [P] and [G] coordinately play a negative reciprocal regulation to the transcription activity? Since O-GlcNAc and O-phosphate exhibit a complex interplay on signaling, transcriptional, and cytoskeletal regulatory proteins within the cell, one of the major functions of O-GlcNAc is to prevent O-phosphorylation and, by doing so, to modulate signaling and transcription in response to cellular nutrients or stress [9], does this negative reciprocal between trend line of ([P]- [G]) and that of RLA give a specific digit evidence to “O-GlcNAc prevent O-phosphorylation” in the above theory? Notice here is glycosylation, not O-GlcNAc.

In contrast, as indicated from the figure that the trend line of RLA tend to have a relation of negative reciprocal to that the trend line of [G] (Figure 2b) and trend line of [G] is the second closet one (among the negative reciprocal relations) to its negative reciprocal RLA (Table 3). If it is true, though Change of signal sensing phosphorylation [P] influence the negative reciprocal regulation of transcription activity by [G], [P] is related to [G], but [G] is independent from [P]. It helps us recall the theory: O-GlcNAc and O-phosphate exhibit a complex interplay on signaling, transcriptional, and cytoskeletal regulatory proteins within the cell, sometimes, O-GlcNAcylation and O-phosphorylation appear to be independently regulated. Does this figure give specific digit evidence to “independently regulated” in the above theory?

Moreover, for all three receptors, as shown in Table 3, sequence of the trend line is: |[G]|<|([P]-[G])|~|RLA|<|[P]|<|([P]+[G])|, that the ([P]+[G]) is the farthest away from the RLA. From opposite aspect, which gives another specific digit proof to the above theory, major function of O- GlcNAc is to prevent O-phosphorylation. Since if [G] play a positive role in the [P], trend line of the ([P]+[G]) would be closer to that of RLA.

Now the question of investigation is does the nutritional and obesity related glycosylation and the signal sensing phosphorylation regulated the transcriptional activity in a negative reciprocal way for the neroendocrine glucocorticoid receptors? Besides, no matter such negative reciprocal exist or not in experimental world, simply from the negative reciprocal relationship indicated by the RLA~([G] or [P]-[G]) figure, we can predict the transcriptional activity of the GR in the same cell type as shown in their corresponding RLA, by counting the [P] and [G].

Declaration of Interest

There is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported

Funding

This research did not receive any specific grant from any funding agency in the public, commercial or not-for-profit sector.

References

Select your language of interest to view the total content in your interested language

Viewing options

Post your comment

Share This Article

Flyer image